rs7337292 chr13:102046065 A>G
- Sequence
ggacttttgtcaatgtcaagatct[A/G]ttctaactcccacttcttgcacaa
- ASB in cell types
- iPS-derived chondrocytes
- ASB for transcription factors
- RARA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RARA_HUMAN | 1.42 | 0.29 | 1.00 | 1.27 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP abnormal involuntary movement scale, biploar disorder (bipolar schizoaffective disorder), college completion, homa-b, lp-pla2 activity, rheumatoid arthritis, years of education