rs73385313 chr10:116797156 T>A
- Sequence
tctctttggagccccagaactcag[T/A]ggcctgagttccttgtcatttgct
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.68 | 0.49 | 1.11 | n/a | n/a |
Items per page:
1 – 1 of 1