rs7338566 chr13:110247702 C>G
- Sequence
tcaagattacagtgaattccattc[C/G]agaggatgcaaaaagaggaaagct
- ASB in cell types
- GM19193 (female B-cells Lymphoblastoid Cell Lines) GBM39 (Human brain tumor) HeLa (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | -1.22 | 2.90 | 1.00 | |||
| GBM39 (Human brain tumor) | -0.92 | 1.42 | 2.00 | |||
| HeLa (cervical adenocarcinoma) | 1.72 | -0.24 | 2.80 |
Items per page:
1 – 3 of 3