rs73388938 chr15:47471737 T>G
- Sequence
gggaggagctagattacaaggtag[T/G]ctgcttttgatttttaagtgtctt
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.09 | 1.14 | 1.48 | n/a | No Hit |
Items per page:
1 – 1 of 1