rs7339017 chr13:110536381 C>T
- Sequence
actgggcggcaggtggatggcctc[C/T]ccctagacaggcaccgaaagtcag
- ASB in cell types
- MDM(monocyte derived macrophages) macrophages form periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | 2.73 | -1.41 | 2.42 | |||
| macrophages form periferal blood | 0.78 | 1.72 | 2.00 |
Items per page:
1 – 2 of 2