rs73393471 chr6:26224401 T>C
- Sequence
cagggatccggagaaactgcgcca[T/C]tgttgtcttacagagaaacaacct
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM19240 (B cells Lymphoblastoid Cell Lines) GM18486 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN TYY1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.80 | 3.18 | 1.00 | n/a | No Hit | |||
| TYY1_HUMAN | 1.76 | -0.27 | 1.17 | -3.90 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
