rs73393835 chr12:105053201 A>G
- Sequence
ttctttcttaacagataaaaggta[A/G]ctcacaagacctctagataatgga
- ASB in cell types
- epidermal keratinocytes GM19240 (B cells Lymphoblastoid Cell Lines) GM19099 (female B-cells Lymphoblastoid Cell Lines) HMF (human mammary fibroblasts)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.59 | -0.65 | 1.11 | n/a | n/a |
Items per page:
1 – 1 of 1