rs73402617 chr9:9912578 T>C
- Sequence
aatgaagctcccctgagagaaagc[T/C]gaataatattaaatggtatcgttg
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM19240 (B cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.77 | 0.38 | 1.11 | n/a | n/a | |||
| CTCF_HUMAN | 1.47 | 1.59 | 1.11 | n/a | No Hit |
Items per page:
1 – 2 of 2