rs73403535 chr9:7052965 G>A
- Sequence
tactgctcgtgatgcattcaaagt[G/A]ttgaattccaaaggacagtttttt
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) GM19239 (male B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.82 | 0.41 | 1.10 | n/a | No Hit | |||
| STAG1_HUMAN | 1.82 | -1.88 | 1.17 | n/a | n/a |
Items per page:
1 – 2 of 2