rs73407681 chr6:35259577 C>T
- Sequence
cggccgcctgggctccaggagccc[C/T]ggaaccaggataagttggatggct
- ASB in cell types
- T47D (invasive ductal carcinoma) lower leg skin monocytes from periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 0.05 | 0.96 | 2.00 | |||
| lower leg skin | 2.73 | n/a | 2.00 | |||
| monocytes from periferal blood | 2.31 | n/a | 3.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Nerve_Tibial, Small_Intestine_Terminal_Ileum, Whole_Blood