rs73407750 chr18:12947197 C>A
- Sequence
cacttccccggccgcttccttccc[C/A]cgggatgacacgtttctacaggcg
- ASB in cell types
- MDM(monocyte derived macrophages) monocyte-derived macrophages from peripheral blood monocytes from periferal blood
- ASB for transcription factors
- SPI1_HUMAN SRBP2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.29 | -1.25 | 2.50 | -1.43 | Weak Concordant | |||
| SRBP2_HUMAN | 1.88 | -0.12 | 2.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
