rs73407797 chr9:14068853 G>A
- Sequence
tccaaattttaatacatagccaca[G/A]ctgccctaaaaaatccagtaagag
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) GM02610 (Lymphoblastoid Cell Lines) GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | 2.78 | -1.75 | 1.00 | |||
| GM02610 (Lymphoblastoid Cell Lines) | -1.56 | 1.85 | 1.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | -2.28 | 1.09 | 1.33 |
Items per page:
1 – 3 of 3