rs7341139 chr5:174045817 G>T
- Sequence
tcctcttcaaattggcttgaatct[G/T]ctctgaccccccacgagtgcagca
- ASB in cell types
- PFSK1 (primitive neuroectodermal tumor)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PFSK1 (primitive neuroectodermal tumor) | 1.44 | -0.59 | 2.00 |
Items per page:
1 – 1 of 1