rs73414615 chr6:43725160 G>A
- Sequence
ctggagcgggccctgtgcactcca[G/A]gcaaggctgcggtttcttctgtgg
- ASB in cell types
- fetal bone marrow-derived mononuclear cells GM02610 (Lymphoblastoid Cell Lines) CD14+ monocytes T47D (invasive ductal carcinoma)
- ASB for transcription factors
- KMT2A_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KMT2A_HUMAN | 3.26 | n/a | 1.50 | n/a | No Hit | |||
| STAT1_HUMAN | 1.76 | n/a | 4.00 | n/a | No Hit |
Items per page:
1 – 2 of 2