rs7341830 chr9:15417301 C>A
- Sequence
tgtggtaggagttattatttttta[C/A]aatttattattattattattttga
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM19240 (B cells Lymphoblastoid Cell Lines) MS-1 (Small cell lung carcinoma)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.34 | 0.20 | 1.06 | n/a | n/a |
Items per page:
1 – 1 of 1