rs73419460 chr11:13153031 A>C
- Sequence
caatatcatccataatacaggaaa[A/C]agtcagcaacaacagacttaatat
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | 0.94 | -0.81 | 1.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | -0.97 | 1.70 | 1.00 |
Items per page:
1 – 2 of 2