rs7342294 chr12:56503 G>A
- Sequence
accctttgaaagaagcagctcgcc[G/A]ctgcaaacttcatgagacagccaa
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.02 | 0.89 | 2.27 | |||
| MCF7 (Invasive ductal breast carcinoma) | -0.02 | 1.13 | 1.95 |
Items per page:
1 – 2 of 2