rs73427878 chr7:120869391 A>G
- Sequence
aagaagctacattttgattggatt[A/G]atttgtagaggaatatatgtcaga
- ASB in cell types
- WA01 (H1, human embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA01 (H1, human embryonic stem cells) | 2.02 | -1.68 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Coronary, Artery_Tibial, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Thyroid, Whole_Blood