rs7342869 chr17:57102434 G>A
- Sequence
taatgggttccagatttaatgtgg[G/A]agagaatttaggtacccatccctt
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CTV-1 (Adult T acute lymphoblastic leukemia) | 1.05 | 1.07 | 1.00 | |||
| MDM(monocyte derived macrophages) | 1.80 | -0.39 | 1.67 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cortex, Brain_Frontal_Cortex_BA9, Colon_Transverse, Lung, Muscle_Skeletal, Testis, Thyroid