rs734306 chr12:98397645 T>G
- Sequence
caacaatctctgagccttaggcct[T/G]ggggaggagccactcggcagtccc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) epidermal keratinocytes CD14+ monocytes ID00014 (lymphoblastoid cell, DiGeorge syndrome)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.65 | 0.79 | 1.11 | |||
| epidermal keratinocytes | -0.56 | 2.28 | 2.00 | |||
| CD14+ monocytes | 1.26 | -0.81 | 3.00 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | -0.72 | 0.74 | 1.00 |
Items per page:
1 – 4 of 4