rs73434004 chr9:29563768 G>A
- Sequence
aacttggtggaaggtgattggatt[G/A]tgggggtggtttcccttatgctgt
- ASB in cell types
- iPSC (induced pluripotent stem cells)
- ASB for transcription factors
- DUX4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| DUX4_HUMAN | -2.78 | 3.02 | 1.00 | 3.85 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
