rs73436744 chr18:56869348 C>A
- Sequence
gaaagaaatatgcatttgcagaac[C/A]tattgtgttccagcagggggctat
- ASB in cell types
- HeLa (cervical adenocarcinoma) GM19239 (male B-cells lymphoblastoid cell line) AG04450 (fibroblasts)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.29 | 0.29 | 1.72 | n/a | No Hit |
Items per page:
1 – 1 of 1