rs73453374 chr15:76308513 A>G
- Sequence
tcccaccaagaatacatgacctga[A/G]tctaatcatgaggaaacaccagac
- ASB in cell types
- iPSC (induced pluripotent stem cells)
- ASB for transcription factors
- DUX4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| DUX4_HUMAN | 3.64 | -3.78 | 1.00 | -4.91 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Breast_Mammary_Tissue, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid