rs73454909 chr12:130761710 G>A
- Sequence
tccacacacagctcagtgcaggcc[G/A]tgagcaagtggtcgcatgcacact
- ASB in cell types
- GM02630 (Fanconi anemi) 2588 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02630 (Fanconi anemi) | -0.59 | 1.23 | 1.00 | |||
| 2588 (Lymphoblastoid Cell Lines) | 1.77 | 0.11 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood