rs73463309 chrX:40553140 G>C
- Sequence
tgcagtaatttgctcacatgtagg[G/C]gccatactgtgtgagaaatatgta
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | n/a | 2.69 | 2.00 | 0.69 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
