rs73463840 chr6:75211381 C>T
- Sequence
aaggatgttatctgattagactca[C/T]tgaatcatttttatccagaatact
- ASB in cell types
- THP-1 (acute monocytic leukemia) upper lobe of left lung GM02610 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.14 | -0.44 | 1.00 | n/a | n/a | |||
| CTCF_HUMAN | 1.03 | 0.45 | 1.46 | n/a | No Hit |
Items per page:
1 – 2 of 2