rs73467659 chr6:75230860 C>T
- Sequence
ttctcttagagagaactggtgtcc[C/T]cagccagaaaaagtgtcctaccat
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) GM19238 (female B-cells lymphoblastoid cell lines) GM02610 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | 1.71 | -1.03 | 1.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | -1.39 | 1.47 | 1.00 | |||
| GM02610 (Lymphoblastoid Cell Lines) | 1.33 | -0.07 | 1.00 |
Items per page:
1 – 3 of 3