rs73491280 chr18:77650722 G>A
- Sequence
tatcacccatttatccatttatcc[G/A]tccatccatgcatttattcgtcca
- ASB in cell types
- GM18505 (female B-cells Lymphoblastoid Cell Lines) GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | 1.36 | -1.04 | 1.00 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | -0.43 | 1.24 | 1.00 |
Items per page:
1 – 2 of 2