rs73493221 chr16:799457 C>A
- Sequence
cctaccctcccactgaggcccacg[C/A]aggctgacccagaccacggtgtga
- ASB in cell types
- HT1080 (fibrosarcoma)
- ASB for transcription factors
- SSRP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SSRP1_HUMAN | -0.99 | 1.84 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cortex, Esophagus_Gastroesophageal_Junction, Nerve_Tibial, Thyroid, Whole_Blood