rs73493786 chrX:50204703 T>C
- Sequence
cgctgattcgtgatctccccctgc[T/C]ggtgagaatggtggggtcaatccg
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.34 | 1.04 | 1.58 | -2.09 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
