rs73495787 chr11:77191988 G>A
- Sequence
ctgtctgaactgaccgttggcccc[G/A]ttgaggctcctcatagtccttccc
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines) GM02630 (Fanconi anemi) GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18486 (Lymphoblastoid Cell Lines) | -2.61 | 3.00 | 1.00 | |||
| GM02630 (Fanconi anemi) | -1.95 | 1.46 | 1.33 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | 2.06 | -1.72 | 1.00 |
Items per page:
1 – 3 of 3