rs73496919 chr11:74870834 C>G
- Sequence
aactcaacaatgaggaggaaaatg[C/G]cctccaaaaccaaattttagtttt
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18486 (Lymphoblastoid Cell Lines) | -0.98 | 1.35 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Nucleus_accumbens_basal_ganglia, Esophagus_Mucosa, Lung, Muscle_Skeletal, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood