rs734999 chr1:2581777 C>T

Sequence
aaatacccgtgggaaagaaaagca[C/T]aacagagaacaggagacttatgtg
ASB in cell types
GM12878 (female B-cells lymphoblastoid cell line)

Color scale

color scale ref
-log10 FDR of Ref (C) ASB
color scale alt
-log10 FDR of Alt (T) ASB

Details

Cell type
Effect size Ref
Effect size Alt
FDR Ref
FDR Alt
Mean BAD
GM12878 (female B-cells lymphoblastoid cell line) 0.07 0.86 1.000.02 1.09
Items per page:
1 – 1 of 1

Motif analysis

No data available

Genetic associations

EMBL-EBI ulcerative colitis
GRASP body mass index (bmi) rheumatoid arthritis ulcerative colitis waist hip ratio
PheWAS abnormal serum enzyme levels adverse effects of sedatives or other central nervous system depressants and anesthetics allergy to serum or vaccine amblyopia anterior pituitary disorders atherosclerosis of renal artery atrial fibrillation atrial fibrillation & flutter atrial flutter atrophy of edentulous alveolar ridge av block bacterial infection nos benign neoplasm of uterus cancer of mouth cardiac and circulatory congenital anomalies cardiac arrhythmia nos cardiac congenital anomalies cardiac dysrhythmias cardiac pacemaker in situ cardiac pacemaker/device in situ central/nonobstroctive sleep apnea cerebrovascular disease chronic cystitis chronic lymphoid leukemia colostomy and enterostomy complication coma stupor and brain damage conjunctivitis, infectious convulsions corns and callosities dermatomyositis and polymyositis develomental delays and disorders diseases of lips diseases of nail diseases of the larynx and vocal cords diseases of the oral soft tissues diseases of white blood cells disorders of fluid, electrolyte, and acid-base balance disorders of the globe disorders of the pituitary gland and its hypothalamic control electrolyte imbalance empyema and pneumothorax epilepsy, recurrent seizures, convulsions exostosis of jaw fever of unknown origin fractur of unspecified part of femur gastroparesis giant cell arteritis h. pylori heart transplant/surgery heart valve disorders hemorrhage from gastrointestinal ulcer hypoventilation hypovolemia infection of the eye intestinal malabsorption intracerebral hemorrhage irritable bowel syndrome ischemic stroke keratitis lyme disease lymphoid leukemia malignant neoplasm, other methicillin resistant staphylococcus aureus muscle weakness mycoses nonrheumatic mitral valve disorders occlusion of cerebral arteries open wounds of extremities otalgia other congenital anomalies other specified diseases of nail pagets disease of bone partial epilepsy poisoning by other anti-infectives polymyalgia rheumatica posttraumatic wound infection progressive myopia prolapse of vaginal vault after hysterectomy respiratory abnormalities retinal hemorrhage/ischemia rheumatoid arthritis & related inflammatory polyarthropathies salicylates causing adverse effects in therapeutic use sciatica sinoatrial node dysfunction speech and language disorder spirochetal infection suicidal ideation or attempt suppurative and unspecified otitis media swelling, mass, or lump in head and neck symptoms involving head and neck urethral stricture (not specified as infectious) urinary tract infection vaginal enterocele, congenital or acquired vascular insufficiency of intestine ventral hernia voice disturbance
GTEx eQTL Adipose_Subcutaneous Adipose_Visceral_Omentum Artery_Aorta Artery_Tibial Brain_Caudate_basal_ganglia Brain_Cerebellar_Hemisphere Brain_Cerebellum Brain_Nucleus_accumbens_basal_ganglia Cells_Cultured_fibroblasts Cells_EBV-transformed_lymphocytes Colon_Transverse Esophagus_Gastroesophageal_Junction Esophagus_Mucosa Esophagus_Muscularis Heart_Atrial_Appendage Liver Lung Nerve_Tibial Ovary Pancreas Pituitary Skin_Not_Sun_Exposed_Suprapubic Skin_Sun_Exposed_Lower_leg Small_Intestine_Terminal_Ileum Spleen Thyroid Whole_Blood

Download