rs73505445 chr11:66747864 C>T
- Sequence
aaactgttgagctcaagtgatcct[C/T]tcacctcggcctcccaaagtgctg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.01 | 1.09 | 1.35 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Stomach, Testis, Thyroid, Whole_Blood