rs73523868 chr8:383105 G>A
- Sequence
gttcactgagagacaagtgcaaac[G/A]tgtccctatcagcactggttgaac
- ASB in cell types
- keratinocytes
- ASB for transcription factors
- P63_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| P63_HUMAN | -0.10 | 1.82 | 1.00 | 7.65 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
