rs73526743 chr11:88104069 G>A
- Sequence
ctaactgaacttttcccctatctg[G/A]tgggctttggcaacactttctcca
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) GM19239 (male B-cells lymphoblastoid cell line) GM02255 (Lymphoblastoid Cell Lines) GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | -0.31 | 0.85 | 1.00 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | 1.02 | -0.40 | 1.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | -0.31 | 0.94 | 1.00 | |||
| GM18486 (Lymphoblastoid Cell Lines) | -0.36 | 1.08 | 1.00 |
Items per page:
1 – 4 of 4