rs73528972 chr16:19086731 G>C
- Sequence
gggacaacgcccggcaggagggcc[G/C]ggtcattgctgcgcgttatatatg
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19238 (female B-cells lymphoblastoid cell lines) | 0.51 | 0.30 | 1.17 |
Items per page:
1 – 1 of 1