rs7354668 chr20:4761064 A>C
- Sequence
acacctgtcgggggttctgctaga[A/C]agaaagatgcagagcgcccctcac
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) GM10847 (female B-cells Lymphoblastoid Cell Lines) GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | -0.62 | 1.17 | 1.00 | |||
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | -0.54 | 1.83 | 1.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | 1.16 | -0.33 | 1.00 |
Items per page:
1 – 3 of 3