rs7355170 chr1:209248866 T>C
- Sequence
tcctttgttgccacctagtggcca[T/C]taattgcactacaccacatagcta
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | 1.00 | 0.02 | 1.00 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | -0.33 | 0.57 | 1.00 |
Items per page:
1 – 2 of 2