rs73556726 chr6:134111439 T>C
- Sequence
cctgggcttaagtgattctctcac[T/C]tcagcctcctgagtagctgggact
- ASB in cell types
- CUTLL1 (T-cell lymphoblastic lymphoma 1) NB69 (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CUTLL1 (T-cell lymphoblastic lymphoma 1) | 2.51 | -2.35 | 1.00 | |||
| NB69 (neuroblastoma) | 2.17 | -1.82 | 1.00 |
Items per page:
1 – 2 of 2