rs7355913 chr3:195905259 G>A
- Sequence
tgtcgcccgggctggaatgcagtg[G/A]cgcaatcttggctcactgcaacct
- ASB in cell types
- NOMO-1 (acute monocytic leukemia)
- ASB for transcription factors
- E2F8_HUMAN ZF64B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| E2F8_HUMAN | -1.74 | 2.97 | 2.00 | n/a | No Hit | |||
| ZF64B_HUMAN | -4.61 | 2.11 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Esophagus_Mucosa, Lung, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood