rs73563812 chr8:26042889 G>T
- Sequence
tgcctcgctcttccgaaaagttgt[G/T]cctgggacagagacagggcggaat
- ASB in cell types
- hepatocytes
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| hepatocytes | -1.74 | 2.05 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI cardiovascular disease, medication use (agents acting on the renin-angiotensin system), systolic blood pressure