rs7356735 chr5:120621332 G>C
- Sequence
ggcttcttcctgctgcttgtcttg[G/C]aggtctctattttgtgatcagtct
- ASB in cell types
- definitive endoderm from HUES8
- ASB for transcription factors
- GATA6_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA6_HUMAN | -1.07 | 1.55 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, hdl cholesterol, homa-ir, ldl cholesterol change with statins, total cholesterol change with statins