rs735689 chr12:12983689 T>C
- Sequence
atatgctgtgtgagaactccgtgt[T/C]aaaaattccatggagccaggctag
- ASB in cell types
- RH4 (alveolar rhabdomyosarcoma) transverse colon HMEC (human mammary epithelial cells) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN SMC1A_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.72 | 0.78 | 1.27 | n/a | No Hit | |||
| SMC1A_HUMAN | 1.86 | 0.10 | 1.00 | n/a | n/a | |||
| STAG1_HUMAN | 1.22 | 1.74 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Nerve_Tibial, Ovary, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Stomach, Testis, Thyroid, Whole_Blood