rs735721 chr13:104571874 G>A
- Sequence
ttaactgttgttcagagcaagtcc[G/A]taggagaatgaaattccagttcca
- ASB in cell types
- uterus GM19240 (B cells Lymphoblastoid Cell Lines) MCF7 (Invasive ductal breast carcinoma) right lobe of liver
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| uterus | -1.36 | 1.81 | 1.17 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | 1.74 | -0.77 | 1.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 2.45 | 0.69 | 1.33 | |||
| right lobe of liver | -1.63 | 2.19 | 1.00 | |||
| LUHMES (lund human mesencephalic cells) | 1.07 | -0.71 | 1.00 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), partial epilepsy, psoriasis, resistance to kuru in aged women despite likely exposure