rs73575131 chr10:11720284 T>C
- Sequence
ctaagtctctctgtggcagggcag[T/C]gcttagcagaagggaactgttttt
- ASB in cell types
- monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.79 | -0.22 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1