rs73580853 chr19:58544172 T>C
- Sequence
gcacagcggcccgcttctgtgtgg[T/C]ctggaggtggagctgagaggggaa
- ASB in cell types
- primary B-CLL cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary B-CLL cells | 1.47 | -5.58 | 2.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Thyroid