rs73590888 chr16:53130366 G>A
- Sequence
ggaaactctcgcccttcctcggcg[G/A]acccgagctgcccgagagatgccc
- ASB in cell types
- primary B-CLL cells
- ASB for transcription factors
- BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 1.99 | -0.15 | 1.20 | n/a | n/a |
Items per page:
1 – 1 of 1