rs73593548 chr11:102495589 G>T
- Sequence
cttagtggtttcataagagaaagg[G/T]tgccctcatgtggcgatttagaaa
- ASB in cell types
- neutrophils from periferal blood HCT-116-RAD21-mAC
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils from periferal blood | 3.08 | 0.01 | 1.50 | |||
| HCT-116-RAD21-mAC | 0.25 | 1.56 | 1.00 |
Items per page:
1 – 2 of 2