rs7359370 chr16:76640102 G>A
- Sequence
cgttggtgggagtatcccaggcca[G/A]tgagcaatgagggcaactagggat
- ASB in cell types
- RWPE2 GM12890 (Lymphoblastoid Cell Lines) epithelial cell of prostate GM12892 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.25 | 0.42 | 1.38 | n/a | No Hit | |||
| STAG1_HUMAN | 1.61 | 1.24 | 1.00 | n/a | n/a | |||
| RAD21_HUMAN | 1.13 | 0.01 | 1.38 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP fasting blood glucose, ldl cholesterol change with statins, obesity with early age of onset (age >2), total cholesterol change with statins